View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_86 (Length: 247)
Name: NF17903_low_86
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 51153919 - 51153687
Alignment:
| Q |
1 |
ttaatatatataattttccatttaaagagaacaaataatcaatatctcctttaagccacaccaccatttggtcactagatccatatccttgaagattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51153919 |
ttaatatatataattttccatttaaagagaacaaataatcaatatctcctttaagccacaacaccatttggtaactagatccatatccttgaagattttt |
51153820 |
T |
|
| Q |
101 |
agtcatatatagtatccgatat---ataatgtaagattgtgtcatttttctataattaattatattttaagtaatattctaaattttggctaattttgcc |
197 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51153819 |
agtcatatatagtattcgatatctaattatgtaagattgtgtcatttttctatgattaattatattttaagtaatattctaaattttggctaactttgcc |
51153720 |
T |
|
| Q |
198 |
taacgaattatgccaaagaattcaccatcttaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51153719 |
taacgaattatgccaaagaattcaccatcttaa |
51153687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University