View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_93 (Length: 236)
Name: NF17903_low_93
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3016471 - 3016251
Alignment:
| Q |
1 |
tgaactgattgaagcaaagatgggttttgaaccattgatttggtattgcaagccagaaccaaacagtatttggtctaaaacagtagatagtgcttttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016471 |
tgaactgattgaagcaaagatgggttttgaaccattgatttggtattgcaagccagaaccaaacagtatttggtctaaaacagtagatagtgcttttggg |
3016372 |
T |
 |
| Q |
101 |
tcatatacaccatgtgcaatcaatactcttgttatctcaacctcaaatttggttcttatggggttgtgtttatatagaatatggcttattattttcaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016371 |
tcatatacaccatgtgcaatcaatactcttgttatctcaacctcaaatttggttcttatggggttgtgtttatatagaatatggcttattattttcaatg |
3016272 |
T |
 |
| Q |
201 |
ccaaagctcaaaggttttgtt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3016271 |
ccaaagctcaaaggttttgtt |
3016251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 3044883 - 3044669
Alignment:
| Q |
7 |
gattgaagcaaagatgggttttgaaccattgatttggtattgcaagccagaaccaaacagtatttggtctaaaacagtagatagtgcttttgggtcatat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3044883 |
gattgaagcaaagatgggttttgaaccattggtttggtactgcaagccagaaccaaacagtatttggtctaaaacagtagatagtgcttttgggtcatat |
3044784 |
T |
 |
| Q |
107 |
acaccatgtgcaatcaatactcttgttatctcaacctcaaatttggttcttatggggttgtgtttatatagaatatggcttattattttcaatgccaaag |
206 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3044783 |
acaccatgtgcaattaacactcttgttatctcaacctcaaatttggttcttatggggctgtgtttatatagaatatggcttattattttcaatgccaaag |
3044684 |
T |
 |
| Q |
207 |
ctcaaaggttttgtt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3044683 |
ctcaaaggttttgtt |
3044669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University