View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_96 (Length: 234)
Name: NF17903_low_96
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 80 - 218
Target Start/End: Complemental strand, 34509295 - 34509159
Alignment:
| Q |
80 |
atgcggtggatcaagagaaagaatatgggaataatggctttacatttctctttggtaacattcatcagttcacacaaaattccaccttctctccacacaa |
179 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||||| | |||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
34509295 |
atgcggttgatcaagacaaaaaatatgggaataatggctctctatttctctttggcaacattcatcggttcacataaaattccaccttctctccacacaa |
34509196 |
T |
 |
| Q |
180 |
atttcatttcatttgttgttcttcttcttcaccctcatc |
218 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
34509195 |
atttcattt--tttcttcttcttcttcttcaccctcatc |
34509159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 80 - 218
Target Start/End: Complemental strand, 44619853 - 44619717
Alignment:
| Q |
80 |
atgcggtggatcaagagaaagaatatgggaataatggctttacatttctctttggtaacattcatcagttcacacaaaattccaccttctctccacacaa |
179 |
Q |
| |
|
||||||| |||||||| ||| |||| || |||||||||| | |||||||||||||||||||||| | |||||| ||||||||||||||||||||||||| |
|
|
| T |
44619853 |
atgcggttgatcaagacaaaaaatacggaaataatggctctgcatttctctttggtaacattcaacggttcacgtaaaattccaccttctctccacacaa |
44619754 |
T |
 |
| Q |
180 |
atttcatttcatttgttgttcttcttcttcaccctcatc |
218 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
44619753 |
atttcattt--tttcttcttcttcttcttcaccctcatc |
44619717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 39 - 81
Target Start/End: Complemental strand, 44785171 - 44785129
Alignment:
| Q |
39 |
gaatatgagtgttttatggaaaattacatgcatttactctcat |
81 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44785171 |
gaataggagtgttttatgggaaattacatgcatttactctcat |
44785129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 147 - 218
Target Start/End: Complemental strand, 44785081 - 44785013
Alignment:
| Q |
147 |
gttcacacaaaattccaccttctctccacacaaatttcatttcatttgttgttcttcttcttcaccctcatc |
218 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
44785081 |
gttcacacaaatttccaccttctttccacacaaatttcatt---atgattgttcttcttcttccccctcatc |
44785013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 44621314 - 44621259
Alignment:
| Q |
22 |
gctcagtcaagggtatggaatatgagtgttttatggaaaattacatgcatttactct |
78 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
44621314 |
gctcagtca-gggtatggaatatgagtgttttatgggaaattatgtgcatctactct |
44621259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University