View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_97 (Length: 234)
Name: NF17903_low_97
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_97 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 13049961 - 13049808
Alignment:
| Q |
1 |
cgaatgttctctattcacttcaagtttttagaaaaaacgttttaacaaaatttaacaagtgaaaggaaataaaaatgaattacaagtttatgtaattaca |
100 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13049961 |
cgaatgttctctattctactcaaatttttagcaaaaatgttttaacaaaatttaacaagtgaaaggaaataaaaatgtattacaagtttatgtaattaca |
13049862 |
T |
|
| Q |
101 |
atgtctaac--tttttgaaagttcacttattaaaatttgggttaagagtttgat |
152 |
Q |
| |
|
||||| ||| ||||||||||| |||| | |||| |||||||||||||||||| |
|
|
| T |
13049861 |
atgtcgaacaagttttgaaagtttacttgtaaaaaattgggttaagagtttgat |
13049808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University