View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17904_high_8 (Length: 356)
Name: NF17904_high_8
Description: NF17904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17904_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 16 - 337
Target Start/End: Original strand, 45358729 - 45359047
Alignment:
| Q |
16 |
atgaaagtggaagggaaacctgggcacgttcaaatgggtatctagttttttatgcagaataattatacaaacatgaatcaaaaatgaaggagcataagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45358729 |
atgaaagtggaagggaaacctgggcaagttcaagtgggtatctagttttttatgcagaat---tatacaaacatgaatcaaaaatgaaggagcataagat |
45358825 |
T |
|
| Q |
116 |
atcgggaagtcttggaacatggtaaacagaaactgtttttatgtgcagcgtgaaagttaagcatatagtctcataaagatggtactgcaaaacaatatcg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45358826 |
atcgggaagtcttggaacatggtaaacagaaactgtttttatgtgcagcgtgaaagttaagcatatagtctcataaagatggtactgcaaaacaatattg |
45358925 |
T |
|
| Q |
216 |
gtatatgtttgggcacatggataagaaaaaacctatgctgagatagaggaagatcattctgtaattttcaaacgttgtacggacgtaccaatggcactgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45358926 |
gtatatgtttgggcacatggataagaaaaaacctatgctgagatagaggaagatcattctgtaattttcaaacgttgtacggacgtaccaatggcactgt |
45359025 |
T |
|
| Q |
316 |
ttatgttatttatgttgattaa |
337 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45359026 |
ttatgttatttatgttgattaa |
45359047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University