View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17904_low_10 (Length: 247)
Name: NF17904_low_10
Description: NF17904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17904_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 41123773 - 41124001
Alignment:
| Q |
19 |
ggtttggagtcttactattagatggagaaactgtttgcagtcatatgagtttttaagtttccaacatctatagcgatagggaagacaattattgtacttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41123773 |
ggtttggagtcttactattagatggagaaactgtttgcagtcatatgagtttttaagtttccaacatctatagccatagggaagacaattattgtacttc |
41123872 |
T |
 |
| Q |
119 |
ttctcatggctctcattggtgctcaatcactcctaatttgttgttgaaaacatctttaaaaatagggttatgctccctaattaccgttgccataagtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41123873 |
ttctcatggctctcattggtgctcaatcactcctaatttgttgttgaaaacatctttaaaaatagggttatgctccctaattaccgttgccataagtttc |
41123972 |
T |
 |
| Q |
219 |
tctatatcttttttgctaagtttctacac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41123973 |
tctatatcttttttgctaagtttctacac |
41124001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 206
Target Start/End: Original strand, 46453377 - 46453454
Alignment:
| Q |
130 |
ctcattggtgctcaatcactcctaattt-gttgttgaaaacatctttaaaaatagggttatgctccctaattaccgtt |
206 |
Q |
| |
|
|||||||||| || |||||||| ||||| ||||||||| ||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
46453377 |
ctcattggtggtcgatcactccaaattttgttgttgaagtcattttaaaaaatatggctatgctccctaattaccgtt |
46453454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University