View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17904_low_9 (Length: 267)
Name: NF17904_low_9
Description: NF17904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17904_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 52374345 - 52374578
Alignment:
| Q |
20 |
tgctgctactactactactcaataactgttccttcttattcaaacgctgttaaacaaaattaactcaactcaaccaattgtttctttttcttcaattaac |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374345 |
tgctactactactactactcaataactgttccttcttattcaaacgctgttaaacaaaattaactcaactcaaccaattgtttctttttcttcaattaac |
52374444 |
T |
 |
| Q |
120 |
tatgtcggctcgcattgtagctgaagatgttcccgattcttattttgattttatggaaatggacgacttcacgcgccgccgtgacgccggtgatatgccg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374445 |
tatgtcggctcgcattgtagctgaagatgttcccgattcttatttcgattttatggaaatggacgacttcacgcgccgccgtgacgccggtgatatgccg |
52374544 |
T |
 |
| Q |
220 |
actctcggacagcttctcaaacacgttggagatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52374545 |
actctcggacagcttctcaaacacgttggagatg |
52374578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University