View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17905_low_7 (Length: 297)
Name: NF17905_low_7
Description: NF17905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17905_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 24 - 289
Target Start/End: Original strand, 32218630 - 32218892
Alignment:
| Q |
24 |
agagatagtgtttggttaagagagagacagttacaaaggtagcgatgattgagggtatagaatccctagcccattctgtgtcatatataagagttccaag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
32218630 |
agagatagtgtttggttaagagagagacagttacaaaggtagcgatgattgagggtatagaatccctagcccatt--gtgtcatatataagagttt-aag |
32218726 |
T |
|
| Q |
124 |
gtgtaatgtgatttagtcagagataataataattgttaaaaacagtgaaggtcacctaggaatatgacctggattgtagatgtacagtgtgcataagctt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32218727 |
gtgtaatgtgatttagtcagagataataataattgttaaaaacagtgaaggttacctaggaatatgacctggattgtagatgtacagtgtgcataagctt |
32218826 |
T |
|
| Q |
224 |
tgctagtcatactcgaagattttttctaggatttttcttaatgtagatttttctaggatattcttc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32218827 |
tgctagtcatactcgaagattttttctaggatttttcttaatgtagatttttctaggattttcttc |
32218892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University