View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17906_high_19 (Length: 240)
Name: NF17906_high_19
Description: NF17906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17906_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 45642326 - 45642114
Alignment:
| Q |
12 |
caaaggttgctgaaacacgaagcatgaaggtggaagcgtgacggttgaaggtcgaaaggtgcagtttcatcacgtcaaagggttgaaggtgaaacacatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642326 |
caaaggttgctgaaacacgaagcatgaaggtggaagcgtgaaggttgaaggttgaaaggtgcagtttcatcacgtcaaagggttgaaggtgaaacacatt |
45642227 |
T |
|
| Q |
112 |
tcacatggagaggaaaaggagcattgatgtttcataagtagatagcatggtgtgggagagaggaatggggttgagatgtgaggcatgtaaatgtaaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
45642226 |
tcacatggagaggaaaaggagcattgatgtttcataagtagatagcatggtgtgggagagaggaatagggttgagatgtgaggcttgtaaatgtaaggtt |
45642127 |
T |
|
| Q |
212 |
tgcatgtgattgg |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45642126 |
tgcatgtgattgg |
45642114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University