View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17906_low_17 (Length: 303)
Name: NF17906_low_17
Description: NF17906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17906_low_17 |
 | |
|
| [»] scaffold0007 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 176; Significance: 8e-95; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 80 - 282
Target Start/End: Complemental strand, 149571 - 149368
Alignment:
| Q |
80 |
ctcctttgtcaccaaccatattgttgtcaaataaaaaatggttctaatggagagaggaaaagaaggaagtagaacaaacgtatctatctatctttatgtt |
179 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149571 |
ctcctttgtcaccaaccatgttgttgtaaaataaaaaatggttctaatggagagaggaaaagaaggaagtagaacaaacgtatctatctatctttatgtt |
149472 |
T |
|
| Q |
180 |
ggtgttgtaatgtttattttttgttgagaaaatagggttttaagttaaaaagaaaataattttgaaaaa-gggtgatagatgatagtgatatttattttg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| | |
|
|
| T |
149471 |
ggtgttgtaatgtttattttttgttgagaaaatagggttttaagttaaaaagaaaataattttgaaaaaggggtgataaatgatagtgatgtttatttcg |
149372 |
T |
|
| Q |
279 |
aaaa |
282 |
Q |
| |
|
|||| |
|
|
| T |
149371 |
aaaa |
149368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 192 - 277
Target Start/End: Complemental strand, 149015 - 148929
Alignment:
| Q |
192 |
tttattttttgttgagaaaatagggttttaagttaaaaagaaaataattttgaaa-aagggtgatagatgatagtgatatttatttt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
149015 |
tttattttttgttgagaaaatagggttttaagttaaaaagaaaataattatgaaagaggggtggtagatgatagtgatgtttatttt |
148929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 268
Target Start/End: Complemental strand, 148922 - 148855
Alignment:
| Q |
203 |
ttgagaaaatagggttttaagttaaaaagaaaataattttgaaaaa--gggtgatagatgatagtgat |
268 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| || ||| | ||||||||||||| |||||| |
|
|
| T |
148922 |
ttgagaaattagggtttaaagttaaaaagaaaataatgttaaaagagggggtgatagatgacagtgat |
148855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University