View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17906_low_19 (Length: 287)
Name: NF17906_low_19
Description: NF17906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17906_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 44898372 - 44898115
Alignment:
| Q |
19 |
gtttacctgtcttccaaacaataatcaacaaatggnnnnnnnntagaattgtggctaaaatgagaaactatattagtaaatagatcacctaatgaaacac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44898372 |
gtttacctgtcttccaaacaataatcaacaaatggaaaaaaa-tagaattgtggctaaaatgagaaactatattagtaaatagatcacctaatgaaacac |
44898274 |
T |
|
| Q |
119 |
aactgccctaatcttatatgtaataattaccctgatagttttttcgccattacggcccagttcttccatgatcaaagtagcgtattccccggcctgattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44898273 |
aactgccctaatcttatatgtaataattaccctgatagattcttcgccattacggcccagttcttccatgatcaaagcagcgtattccccggcctgattc |
44898174 |
T |
|
| Q |
219 |
tttatgtttaagaggtcgtttgcactggcactaaggctaataatctcttcaatttcttc |
277 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44898173 |
tttatgtttaagaggtcgtttgcagtggcactaaggctaataatctcttcaatttcttc |
44898115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 264
Target Start/End: Complemental strand, 44913773 - 44913686
Alignment:
| Q |
177 |
agttcttccatgatcaaagtagcgtattccccggcctgattctttatgtttaagaggtcgtttgcactggcactaaggctaataatct |
264 |
Q |
| |
|
||||||||||||||||||| ||| |||||| | ||||| |||| ||||||| |||| | ||||| | |||||||||||| |||||||| |
|
|
| T |
44913773 |
agttcttccatgatcaaagcagcatattcctctgcctgcttctgtatgtttgagagtttgtttgtagtggcactaaggcaaataatct |
44913686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University