View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17906_low_25 (Length: 228)
Name: NF17906_low_25
Description: NF17906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17906_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 42622762 - 42622565
Alignment:
| Q |
14 |
agatgaaggtatggaagcttgggtgacaatggaaatgcataatatagcttacttggaaaatgatagggagtttctcaaatttgctttgcctaatccttgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622762 |
agatgaaggtatggaagcttgggtgacaatggaaatgcataatatagcttacttggaaaatgatagggagtttctcaaatttgctttgcctaatccttgt |
42622663 |
T |
|
| Q |
114 |
gttacaaacatttagtttataatatatgcgaatgaatgaattagtggatgttttgttttgagaaatgattgaaattacacagctcgagaggaactaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
42622662 |
gttacaaacatttagtttataatatatgcgaatgaatgaattagtggatgttttgttttgagaaatgattgaaattacatagctcgataggaactaat |
42622565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University