View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17906_low_27 (Length: 217)
Name: NF17906_low_27
Description: NF17906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17906_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 33545987 - 33545790
Alignment:
| Q |
1 |
atgatggaaggttagcaatcgtccannnnnnnggtggtcaaagtaaaataaatgatcacaactcactactacttcccacgtgcacattagagtatatcca |
100 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33545987 |
atgatggaaggttagctatcgtccatttttttggtggtcaaagtgaaataaatgatcacaactcactactactttccacgtgcacattagagtatatcca |
33545888 |
T |
|
| Q |
101 |
cgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatcataaatttataatttattaataatattttcggttaatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33545887 |
cgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatcataaatttataatttattaataatattttcggttaatatt |
33545790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University