View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_high_11 (Length: 402)
Name: NF17907_high_11
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_high_11 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 36 - 382
Target Start/End: Complemental strand, 16913739 - 16913391
Alignment:
| Q |
36 |
tcaattactgcaatttctcgcttgtgggttgattataatgctggaattatttgtttataaaaaattagagnnnnnnnnggtaaactaaaaattagagttg |
135 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16913739 |
tcaattactgcaatttctcgctcgtgggttgattctaatgctggaattctttgtttataaaaaattggagttttttttagtaaactaaaaattagagttg |
16913640 |
T |
 |
| Q |
136 |
atnnnnnnnn-tgccttgccccagatctaaaaattcaaattggaatgnnnnnnnn-ggaacagttgcatacaataacatagcaagagaagactaaaatgg |
233 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16913639 |
ataaaaaaaaatgccttgccccagatctaaaaattcaaattggaatgaaaaaaaaaggaacagttgcatacaataacatagcaagagaagactaaaatgg |
16913540 |
T |
 |
| Q |
234 |
ctgaagactgaatagatgaaaatgtgacgctgcaattttaaaaacttaacaccatggtacaaatttatccaatggttatgatttaaccctctcatctctc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16913539 |
ctgaagactgaatagatgaaaatgtgacgctgcaattttaaaaacttaacaccatggtaaaaatttatccaatggttatgatttaaccccctcatctctc |
16913440 |
T |
 |
| Q |
334 |
acaatataatattgcttgcttctctggacaaatggaagaccaatcatat |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16913439 |
acaatataatattgcttgcttctctggacaagtggaagaccaatcatat |
16913391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 39933489 - 39933457
Alignment:
| Q |
307 |
ggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39933489 |
ggttatgatttaaccctctcatctctcacaata |
39933457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 39933561 - 39933600
Alignment:
| Q |
300 |
atccaatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
39933561 |
atccaagggttatgatttaaccctcttatctctcacaata |
39933600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 339
Target Start/End: Complemental strand, 35653177 - 35653141
Alignment:
| Q |
303 |
caatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35653177 |
caatggttaggatttaaccctctcatctctcacaata |
35653141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 36502369 - 36502408
Alignment:
| Q |
300 |
atccaatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
36502369 |
atccaatggttaggattaaaccctctcatctctcacaata |
36502408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 36497031 - 36496999
Alignment:
| Q |
307 |
ggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
36497031 |
ggttgtgatttaaccctctcatctctcacaata |
36496999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 335
Target Start/End: Complemental strand, 15248935 - 15248900
Alignment:
| Q |
300 |
atccaatggttatgatttaaccctctcatctctcac |
335 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15248935 |
atccaagggttatgatttaaccctctcatctctcac |
15248900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 339
Target Start/End: Complemental strand, 51184577 - 51184538
Alignment:
| Q |
300 |
atccaatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
51184577 |
atccaaaggttataatttaaccctctcatctctcacaata |
51184538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 13784888 - 13784933
Alignment:
| Q |
294 |
aaatttatccaatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
||||| |||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13784888 |
aaattgatccaaaggttatggtttaatcctctcatctctcacaata |
13784933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 23902823 - 23902778
Alignment:
| Q |
294 |
aaatttatccaatggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
||||| |||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
23902823 |
aaattgatccaaaggttatggtttaatcctctcatctctcacaata |
23902778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 150403 - 150371
Alignment:
| Q |
307 |
ggttatgatttaaccctctcatctctcacaata |
339 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
150403 |
ggttatggtttaaccctctcatctctcacaata |
150371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 332
Target Start/End: Complemental strand, 22405836 - 22405800
Alignment:
| Q |
296 |
atttatccaatggttatgatttaaccctctcatctct |
332 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
22405836 |
atttatccaatggtcaagatttaaccctctcatctct |
22405800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University