View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_high_15 (Length: 342)
Name: NF17907_high_15
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 5713125 - 5713393
Alignment:
| Q |
20 |
ctagtagatcagctggaacatgattcagcagctaaggttactggcatgcttctggagatggaccagcctgaagcattgcatttgattgagtcaccagatg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
5713125 |
ctagtagatcagctggaacatgattcagcagctaaggttactggcatgcttctggagatggaccagcctgaagtattgcatttgatcgagtcaccagatg |
5713224 |
T |
 |
| Q |
120 |
ctctcaaggctaaagttgctgaagccatggaggtgttgagaaatgttggtcaacagcaaggaaacagcccggcggatcaactagcctcactctctctcaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713225 |
ctctcaaggctaaagttgctgaagccatggaggtgttgagaaatgttagtcaacagcaaggaaacagcccggcggatcaactagcctcactctctctcaa |
5713324 |
T |
 |
| Q |
220 |
tgactcttagatttctattaatccgtctacatgaattccacaccatcatttctataccccccacaccccg |
289 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5713325 |
tgactcttaga-ttctattaatccgtctacatgaattccacaccatcatttctataccccccaaaccccg |
5713393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 53 - 216
Target Start/End: Complemental strand, 47003814 - 47003651
Alignment:
| Q |
53 |
aaggttactggcatgcttctggagatggaccagcctgaagcattgcatttgattgagtcaccagatgctctcaaggctaaagttgctgaagccatggagg |
152 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| | || ||| |||||||||||||||| ||||||||| ||||||||||||| ||| |||| | |
|
|
| T |
47003814 |
aaggttactggtatgcttttggagatggaccagcctgaggtgttacatctgattgagtcaccagaggctctcaagactaaagttgctgaggccgtggatg |
47003715 |
T |
 |
| Q |
153 |
tgttgagaaatgttggtcaacagcaaggaaacagcccggcggatcaactagcctcactctctct |
216 |
Q |
| |
|
||||||||||||||| || |||||| |||||||| | |||||||| || || |||||||| |
|
|
| T |
47003714 |
tgttgagaaatgttgcacagcagcaatcgaacagcccaactgatcaacttgcttctctctctct |
47003651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 117
Target Start/End: Original strand, 33422420 - 33422481
Alignment:
| Q |
56 |
gttactggcatgcttctggagatggaccagcctgaagcattgcatttgattgagtcaccaga |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |||| ||| | ||||||||||| |
|
|
| T |
33422420 |
gttactggtatgcttctggagatggaccagactgaagttctgcacttgctcgagtcaccaga |
33422481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University