View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_high_21 (Length: 297)
Name: NF17907_high_21
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 43873934 - 43873652
Alignment:
| Q |
1 |
ccgagtaaatggttggggtgcttcactcgccaataattattctcgcaagttaagcttctttttcatcaaatcaaccattctcagatcagattagatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43873934 |
ccgagtaaatggttggggtgcttcactcgccaatacttattctcgcaagttaagcttctttttcatcaaatcaaccattctcagatcagattagatccat |
43873835 |
T |
 |
| Q |
101 |
tttatttatttattttcgtgtgatcttgtaactaacaaatcagaaaattgatttaacttcaactttcaggctgatatacttgttcgtggctatggtggat |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43873834 |
tttatttattt----tcgtgtgatcttgtaactaacaaatcagaaaattgatttaacttcaactttcaggctgatatacttgttcgtggctatggtggat |
43873739 |
T |
 |
| Q |
201 |
acaacactagatgggctttattcttactccatcatctcttccctctagaatcaactaaaccacctcttgctaccgcaatattcttcg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43873738 |
acaacactagatgggctttattcttactccatcatctcttccctctagaatcaactaaaccacctcttgctaccgcaattttcttcg |
43873652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University