View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_high_24 (Length: 239)
Name: NF17907_high_24
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5688316 - 5688095
Alignment:
| Q |
1 |
ctatttctttgtgaactttatcaaattcgaagaagattgacgaattaagatactagttaggtttttgctttactattaatccggaagggtgaagtggtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5688316 |
ctatttctttgtgaactttatcaaattcgaagaagattgacgaattaagatactagttaggtttttgctttactattaatccggaagggtgaactggtgg |
5688217 |
T |
|
| Q |
101 |
aggaaatttgctcatgtcttaaatattttgtggtatattaatggtgattttattggcattttgtcaccaattgagaagaaaggttgaaatgaaagatatc |
200 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5688216 |
atgaaacttgctcatgtcttaaatattttgtggtatattaatggtgattttattggcattttgtcaccaattgagaagaaaggttgaaatgaaagatatc |
5688117 |
T |
|
| Q |
201 |
attggctttttaatgggtttag |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5688116 |
cttggctttttaatgggtttag |
5688095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University