View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_14 (Length: 363)
Name: NF17907_low_14
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 53612485 - 53612842
Alignment:
| Q |
1 |
agaagaagaagttgtgatggaagagtaatgcagccatgcaatgtctttagacctataaataatggcttttactgagagtagaaaacaaagtttctctagg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53612485 |
agaagaagaagtcgtgatggaagagtaatgcagccatgcaatgtctttagacctataaataatggcttttactgagagtagaaaacaaagtttctctagg |
53612584 |
T |
 |
| Q |
101 |
aaacttagtccaagtcctttaggatttagttttggcacttggccagccacaacttcagatagttttatttgtctgttttcaatctaccggttgaattcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53612585 |
aaacttagtccaagtcctttaggatttagttttggcacttggccagccacaacttcagataattttatttgtctgttttcaatctaccggttgaattcag |
53612684 |
T |
 |
| Q |
201 |
atggttctgttctgatgtatgatcttccacacgatacataacttctttatctagtctccagcattattataaagtttggtgtcactaaatgaatgttttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53612685 |
atggttctgttctgatgtatgatcttccacacgatacataacttctttatctagtctccagcattattataaagtttggtgtcactaaatgaatgttttg |
53612784 |
T |
 |
| Q |
301 |
agcaatagaagtcttctaccctgaatataaagtattgcaaatttgcaactgatgatgt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53612785 |
agcaatagaagtcttctacccttaatataaagtattgcaaatttgcaacttatgatgt |
53612842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University