View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_15 (Length: 352)
Name: NF17907_low_15
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 240 - 337
Target Start/End: Complemental strand, 2656614 - 2656517
Alignment:
| Q |
240 |
ttttcttgtccaacattcacttccttttcctttctcctcttttttcactgttattatgatttgatatcaaacaaactttactactgttacttactact |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2656614 |
ttttcttgtccaacattcacttccttttcctttctcctcttttttcactgttactatgatttgatatcaaagaaactttactactgttacttactact |
2656517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 55 - 151
Target Start/End: Complemental strand, 2656746 - 2656652
Alignment:
| Q |
55 |
acagaagatcatatcatccatcactgcgctgtcttttgtttttctcgtgtgtgagagaattttcagtccttctctctcttgtctctaccttcttttg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2656746 |
acagaagatcatatcatccatcactgcgctgtcttttgtttttctcgtgtgtgagagaattttcagtccttct--ctcttgtctctaccttcttttg |
2656652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University