View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_18 (Length: 328)
Name: NF17907_low_18
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 11 - 312
Target Start/End: Complemental strand, 43092618 - 43092308
Alignment:
| Q |
11 |
ttattcttagcttaagtattttttgactggtgtaacttagttggtggtaaaagatttata-----------tgaacactttatattccgagtgctagttt |
99 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43092618 |
ttattcttagcttaagtattttttagcaggtgtaacttaggtggtggtaaaagatttatacgaacactttatgaacactttatattccgagtgctagttt |
43092519 |
T |
 |
| Q |
100 |
gactccgtaatacccttcttccatgtattagtgccggttttgccgctaaactcttcaaaaacnnnnnnn-gctgaattatattttaggccttgcaaaata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43092518 |
gactccgtaatacccttcttccatgtattagtgccggttttgccgttaaactcttaaaaaatatttttttgctgaattatattttaggccttgcaaaata |
43092419 |
T |
 |
| Q |
199 |
aattactttgattttaatccctaaaacttccaaaacaattaactagggtgttcaaaacacgatccagtcttgcaatccgttcttcttatgatttgggtct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43092418 |
aattactttgattttaatccctaaaactcccaaaacaattaactagggtgttcaaaacacgatccagtcttgcaatccgt---tcttatgatttgggtct |
43092322 |
T |
 |
| Q |
299 |
aatccggtcaaatt |
312 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43092321 |
aatccggtcaaatt |
43092308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University