View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_24 (Length: 249)
Name: NF17907_low_24
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 27725181 - 27724971
Alignment:
| Q |
1 |
gtacattggggtcaccctgccaacatggttagtttaataaata----ctaactgatttcagttatagaaagagcgttggttagttaagttagttaattaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725181 |
gtacattggggtcaccctgccaacatggttagttaaataaataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaa |
27725082 |
T |
|
| Q |
97 |
cgttttctgtcacatgaattgctcttgcaggcagtggtgctgtttgctatgggtggttatggtacctatctgggttttcgcattcgttattccgatgacg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| | |
|
|
| T |
27725081 |
cgttttctgtcacatgaattgctcttgcaggcagtggtgctgtttgctatgggtggttacggtacctatctgggttttcgcattcgattttccgatgatg |
27724982 |
T |
|
| Q |
197 |
tagtaagctat |
207 |
Q |
| |
|
| ||| ||||| |
|
|
| T |
27724981 |
tggtacgctat |
27724971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University