View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_30 (Length: 223)
Name: NF17907_low_30
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_30 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32373764 - 32373542
Alignment:
| Q |
1 |
ctgcaaatttacagactcaagccggatggaaatcagtattgaatttgttatcagttgcatggagacatcccgaaacttatgaccttgcaatcgaggcatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32373764 |
ctgcaaatttacagactcaagtcggatggaaatcagtattgaatttgttatcagttgcatggagacatcccgaaacttatgacctcgcaatcgaggcatt |
32373665 |
T |
|
| Q |
101 |
gatatctttattctctgatgccactaatgtaacacgagcgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacagtccaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373664 |
gatatctttattctctgatgccactaatgtaacacgaacgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacagtccaata |
32373565 |
T |
|
| Q |
201 |
gagaagaaaaagaagatattaga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32373564 |
gagaagaaaaagaagatattaga |
32373542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University