View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17907_low_32 (Length: 218)
Name: NF17907_low_32
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17907_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 38717039 - 38716852
Alignment:
| Q |
17 |
cataaaccaaatttctttccttagatannnnnnnaagaacaattatcattatcaaattcaaatgtcactaatgttattttgcaacattttcaagagattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717039 |
cataaaccaaatttctttccttagatatttttttaagaacaattatcattatcaaattcaaatgtcactaatgttattttgcaacattttcaagagattt |
38716940 |
T |
 |
| Q |
117 |
gaactttgttcggtaaggttacaagtttaagctcttaccactgaacttacacctcgacattgtgaattgtaatatagatcaatatttt |
204 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38716939 |
gaactttgtttgataaggttacaagtctaagctcttaccactgaacttacacctcgacattgtaaattgtaatatagatcaatatttt |
38716852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 253081 - 253129
Alignment:
| Q |
112 |
gatttgaactttgttcggtaaggttacaagtttaagctcttaccactga |
160 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
253081 |
gatttgaactttgtaccttaaggttacaaggctaagctcttaccactga |
253129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University