View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17908_high_11 (Length: 237)
Name: NF17908_high_11
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17908_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 10521952 - 10522152
Alignment:
| Q |
21 |
cgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgattaagtaaaatattatccaaacaacaatttcttggcat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10521952 |
cgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgtttaagtcaaatattatccaaacaacaatttcttggcat |
10522051 |
T |
 |
| Q |
121 |
cacctatgggtcataacctaagttatgtgtggagcagtatttttaacgggaaaattattgtgtgtgcatgatctcgatggtgcatcgggtcaggtgcaaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10522052 |
cacctatgggtcataacctaagttatgtgtggagcagtagttttaacggaaaatttattgtatgtgcaggatctcgatggtgcatcgggtcaggtgcaaa |
10522151 |
T |
 |
| Q |
221 |
c |
221 |
Q |
| |
|
| |
|
|
| T |
10522152 |
c |
10522152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University