View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17908_high_12 (Length: 217)
Name: NF17908_high_12
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17908_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 19546208 - 19546393
Alignment:
| Q |
14 |
cataggtggttgatcaggtgctttatcatgcacaaggcgagccacattcgtagcaatatgcacagcgaaaatttgatggtggcagtggtaatgggcagca |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19546208 |
catagatggttgatcaggtgctttatcatgcacaaggcgagccacattcgtggcaatatgcacagtgaaaatttgatggtggcagtggtaatgggcagca |
19546307 |
T |
|
| Q |
114 |
gccaaatgcaacatagatgcggcgatgtttaaagctcgtatnnnnnnntgttggaggaatgtggcgggtcaatttattggagcgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19546308 |
gccaaatgcaacatagatgcggcgatgtttaaagctcgtatgggggcgtgttggaggaatgtggcgggtcaatttattggagcgat |
19546393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University