View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17908_low_11 (Length: 248)
Name: NF17908_low_11
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17908_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 118 - 241
Target Start/End: Original strand, 42141833 - 42141952
Alignment:
| Q |
118 |
tgaattccttacttgagattacaacgttttgcagcaatgatctaattaagtcataatattcggcctatggagcatgaagaagcttccaagtgcattgtgt |
217 |
Q |
| |
|
|||| ||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
42141833 |
tgaactccttacttgagattaccatgttttgcagcaatgatctaa----gtcataatattcggcctatagagcatgaagaagcttccaagtgcattgtct |
42141928 |
T |
|
| Q |
218 |
gtcactagctttaaccctttgcta |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42141929 |
gtcactagctttaaccctttgcta |
42141952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 37 - 122
Target Start/End: Original strand, 42141719 - 42141804
Alignment:
| Q |
37 |
aagtttttgtgttatgtatgtctagacaaaataggaataaaataattgtagaagagaaaaactatttttagttaaatgacatgaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42141719 |
aagtttttgtgttatgtatgtctagacaaaataggaataaaataattggagaagagaaaaactatttttaattaaatgacatgaat |
42141804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 109
Target Start/End: Complemental strand, 8550587 - 8550540
Alignment:
| Q |
59 |
tagacaaaataggaataaaataattgtagaagagaaaaactatttttagtt |
109 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
8550587 |
tagacaaaataggattaaaataattg---aagagaaaaactatttttagtt |
8550540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University