View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17908_low_15 (Length: 232)
Name: NF17908_low_15
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17908_low_15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 9054949 - 9054734
Alignment:
| Q |
14 |
ataaacaatatgaaagaataacttcaaaatagcttaggaagtaatttctttaagaaagatcacatcgaaaaggatgcagtgaatccataactccaacttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9054949 |
ataaacaatatgaaagaataacttcaaaatagcttaggaagtaatttctttaagaaagataacatcgaaaaggatgcagtgaatccataactccaacttt |
9054850 |
T |
|
| Q |
114 |
acaagacaataagccatagcacttcaaagataaaaaagtgtcactgttattgcaggatgagacaagctggacaatctttttattcaaagcaattttcatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9054849 |
acaagacaataagccatagcacttcaaagttaaaaaagtgtc---tttattgcaggatgagacaagctggacaatctttttattcaaagcaattttcatg |
9054753 |
T |
|
| Q |
214 |
gtatcgacagactgatact |
232 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
9054752 |
gtatcaacagactgatact |
9054734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University