View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17908_low_8 (Length: 295)
Name: NF17908_low_8
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17908_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 42 - 287
Target Start/End: Original strand, 7095234 - 7095479
Alignment:
| Q |
42 |
tcttctcttctttctctatgattcatatttgttaacaattacacatggagatagaattactacactattattgtgaatgaaaagaaaacaagtttgtgcc |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095234 |
tcttctcttctttctctatgattcatttttgttaacaattacacatggatatagaattaccacactattattgtgaatgaaaagaaaacaagtttgtgcc |
7095333 |
T |
 |
| Q |
142 |
tttcccattttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaactcacaagatccaaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7095334 |
tttcccattttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaattcacaagatccaaat |
7095433 |
T |
 |
| Q |
242 |
ctaatccacgggtttctttttaggtcactaatcaatccttcttctc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095434 |
ctaatccacgggtttctttttaggtcactaatcaatccttcttctc |
7095479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University