View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_high_26 (Length: 275)
Name: NF17909_high_26
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 35319999 - 35319794
Alignment:
| Q |
18 |
tgatgatgatacatggagttgttgatagcttccctgtgagtattatcatcatcaccagaatccattctggaagtactcatttgagtattagcaccaaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35319999 |
tgatgatgatacatggagttgttgatagcttccctgtgagtattatcatcatcaccagaatccattctggaagtactcatttgagtattagcaccaaggt |
35319900 |
T |
 |
| Q |
118 |
taagatacaccaaccttgaatccatgttattgttgttgtggctatggcggtgatcttcattcatattatgatgaggatacatatttgttgctgaagaagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35319899 |
taagatacaccaaccttgaatccatgttattgttgttgtggctatggtggtgatcttcattcatattatgatgaggatacatatttgttgctgaagaagc |
35319800 |
T |
 |
| Q |
218 |
tgttgc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
35319799 |
tgttgc |
35319794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University