View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_high_40 (Length: 222)
Name: NF17909_high_40
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 39996223 - 39996033
Alignment:
| Q |
14 |
atgaaacagtaaccggtcatatttggagaagtgcatgtaaagcaagagagcatgaaaatgaccaaccaaccgcgcttggtgtttgcgttgattggaggcg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39996223 |
atgaaacagtaaccggtcatatttggagaagtgcatgtaaagcaagagagcataaaaatgaccaaccaaccgcgcttggtgtttgtgttgattggaggcg |
39996124 |
T |
|
| Q |
114 |
tcgtgtggaacctaatttacctaaagggtattttgggaatgccattttagatgttttggctactagtctaacaggtgatttaatgtctaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39996123 |
tcgtgtggaacctaatttacctaaagggtattttgggaatgccattttagatgttttggctactagtctagcaggtgatttaatgtctaaa |
39996033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 53037369 - 53037558
Alignment:
| Q |
14 |
atgaaacagtaaccggtcatatttggagaagtgcatgtaaagcaagagagcatgaaaatgaccaaccaaccgcgcttggtgtttgcgttgattggaggcg |
113 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| ||||||| |||| ||||| ||||||||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
53037369 |
atgaaaccttaaccggtcatgtttggagaagtgcaagtaaagctagagggcatgcaaatgaccaacaaacttcgcttggtgtttgtgttgattggaggaa |
53037468 |
T |
|
| Q |
114 |
tcgtgtggaacctaatttacctaaagggtattttgggaatgccattttagatgttttggctactagtctaacaggtgatttaatgtctaa |
203 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| | ||| |||||| ||||||||||||| |||| |||||||| ||||| |
|
|
| T |
53037469 |
tcgtgtggagcctaatttaccaaaagggtattttgggaatgggactttggatgttgtggctactagtcttgcaggggatttaatatctaa |
53037558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University