View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_low_16 (Length: 407)
Name: NF17909_low_16
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 18 - 403
Target Start/End: Original strand, 35915852 - 35916237
Alignment:
| Q |
18 |
agaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915852 |
agaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgattt |
35915951 |
T |
|
| Q |
118 |
gcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915952 |
gcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgct |
35916051 |
T |
|
| Q |
218 |
gttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916052 |
gttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatg |
35916151 |
T |
|
| Q |
318 |
ctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916152 |
ctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University