View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_low_25 (Length: 303)
Name: NF17909_low_25
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 17 - 171
Target Start/End: Complemental strand, 13072263 - 13072109
Alignment:
| Q |
17 |
agaattattgaggaggatttttcttttgttcaacatgatggaaacgtgtccaatactaaattttggttggtataagttgccttatgattgagttattatg |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072263 |
agaattattgaagaggatttttcttttgttcaacataatggaaatgtgtccaatactaaattttggttggtataagttgccttatgattgagttattatg |
13072164 |
T |
|
| Q |
117 |
aagataaacatttgaacttggtagcagcttaaatgttttaaggaattgaatagta |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072163 |
aagataaacatttgaacttggtagcagcttaaatgttttaaggaattgaatagta |
13072109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 196 - 302
Target Start/End: Complemental strand, 13072085 - 13071980
Alignment:
| Q |
196 |
ggaatgtaatgcatttgaactgttactatgatactgatgccaaacacttatatatcacactttattcttctgctagtgcataatttttcatttatattct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13072085 |
ggaatgtaatgcatttgaactgttactatgatactgatgccaaacacttatatatcacactttattcttctgctagtgcataatttttcatttatatt-t |
13071987 |
T |
|
| Q |
296 |
tggacat |
302 |
Q |
| |
|
||||||| |
|
|
| T |
13071986 |
tggacat |
13071980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University