View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_low_27 (Length: 288)
Name: NF17909_low_27
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 13072557 - 13072295
Alignment:
| Q |
17 |
atctccatgtggggattgggatttcctagggtccaaataattgacttggatcctctacaccttcattatggtgattcagctttagggaccgttggatt-a |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13072557 |
atctccatgtgggggttgggatttcctagggtccaaataattgacttggatcctctacaccttcattatggtgattcagctttagggaccgttggattta |
13072458 |
T |
 |
| Q |
116 |
gagagaaaaacttttgactgcagtaactttcagcnnnnnnnactgcagtgaatttgagtcctctacaatagattggattcaagtatttgaatttgaagta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072457 |
gagagaaaaacttttgactgcagtaactttcagctttttttactgcagtgaatttgagtcctctacaatagattggattcaagtatttgaatttgaagta |
13072358 |
T |
 |
| Q |
216 |
gcatttttgataagttgttatatgacttagatctattgttatgccgagggatatggttctgtg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
13072357 |
gcatttttgataagttgttatatgacttagatctattgttatgctgagggatatggttttgtg |
13072295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University