View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_low_37 (Length: 240)
Name: NF17909_low_37
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 47365598 - 47365736
Alignment:
| Q |
1 |
cttttttcatagttttccccttctgctaaatgctcaattatttttgtgacaaacatagtacaattaaggacagacaaactgaaggtgaacttaggaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365598 |
cttttttcatagttttccccttctgctaaatgctcaattatttttgtgacaaacatagtacaattaaggacagacaaactgaaggtgaacttaggaacag |
47365697 |
T |
 |
| Q |
101 |
atactagaattttatatgcaaatttcacatatttaatac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365698 |
atactagaattttatatgcaaatttcacatatttaatac |
47365736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 47365793 - 47365837
Alignment:
| Q |
196 |
ctttagtggattagattgacaaactgaagtcaccttactatattc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365793 |
ctttagtggattagattgacaaactgaagtcaccttactatattc |
47365837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University