View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17909_low_45 (Length: 210)
Name: NF17909_low_45
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17909_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 30413568 - 30413378
Alignment:
| Q |
1 |
ctctaacccacactttttgtcaaaaaagagcaacacttatcactttcatatttatatgaaccaatcttttatttcaatgctaccaaataataatttagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30413568 |
ctctaacccacactttttgtcaaaaaagagcaacacttatcactttcatatttatatgaaccaatcttttatttcaatgctaccaaataataattaagct |
30413469 |
T |
|
| Q |
101 |
actttnnnnnnnnttgatgcaacctactttgccacctcaagttcttccaattttgagtagaaaaaataacgaacaaatcctttctcccatt |
191 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413468 |
actttaaaaaaaattgatgcaacctactttgccaccttaagttcttccaattttgagtagaaaaaataacgaacaaatcctttctcccatt |
30413378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University