View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1790_high_18 (Length: 239)
Name: NF1790_high_18
Description: NF1790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1790_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 65 - 232
Target Start/End: Original strand, 11196941 - 11197108
Alignment:
| Q |
65 |
agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11196941 |
agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat |
11197040 |
T |
 |
| Q |
165 |
acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11197041 |
acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgct |
11197108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University