View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1790_low_16 (Length: 245)
Name: NF1790_low_16
Description: NF1790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1790_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 50909585 - 50909362
Alignment:
| Q |
1 |
tgacaaagtgcaaattcataatttttaacatattcaaatttcaaaatctttgtgtaaaatacattttttaagacttttacacatccggactttgaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50909585 |
tgacaaagtgcaaattcataatttttaacatattcaaatttcaaaatctttgtgtaaaatacattttttaagacttttacacatccggactttgaaattc |
50909486 |
T |
 |
| Q |
101 |
gaatgcgtgaaattcagttttctcgttgaaatatgctgccatagtgtatgcgtctctatgctgaatctcaagttcaaacaagtggagaccacattttcta |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50909485 |
gaatgcgtgaaattcacttttctcgttgaaatatgctgccatagtgtatgcgtctctatgctgaatctcaagttcaaacaagttgagaccacattttctg |
50909386 |
T |
 |
| Q |
201 |
tgtgtgcaagcaagcagttgactagttttt |
230 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
50909385 |
tgt------gcaagcagttgactagttttt |
50909362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University