View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1790_low_22 (Length: 227)
Name: NF1790_low_22
Description: NF1790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1790_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 30415816 - 30415621
Alignment:
| Q |
15 |
aaaatcaaagaacaaatgctataagagtaaccctgcatccaagagcaggaacttcatctcttccacaactatatgaagctgaaattgttataaactccca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30415816 |
aaaatcaaagaacaaatgctataagagtaaccctgcatccaagagcaggaacttcatctcttccacaactatatgaagctgaaattgttataaactccca |
30415717 |
T |
|
| Q |
115 |
tttaccttgggctaaagagttaattcgaaattggaagtggactttttatgtttgggtgtcattatatgtgtacattgtgctacttatgcttctctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30415716 |
tttaccttgggctaaagagttaattcgaaattggaagtggactttctatgtttgggtgtcattatatgtgtacatcgtgctacttatgcttctctt |
30415621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University