View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17911_high_19 (Length: 238)
Name: NF17911_high_19
Description: NF17911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17911_high_19 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 30799 - 31003
Alignment:
| Q |
16 |
ataatactttgagaaatagaagaaattaaatataatgtatttgtgttgcgccggtgtccgacaccgacacatgtcaaacactatactcatatttaatcta |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30799 |
ataatattttgagaaatagaagaaattaaatataatgtatttgtgtcgtgccggtgtccgacaccgacacatgtcaaacactatactcatatttaatcta |
30898 |
T |
 |
| Q |
116 |
aagtgtcagtgctacataatataaataccaagaaaaatttaaatgtgaaaaatcaatctattcatacctttagtaaattggcaatataagtttgtggtgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30899 |
aagtgtcagtgctacataatataaatactaagaaaaatttaaatgtgaaaaatcaatctattcatacctttagtaaattggcaatataagtttgtggtgg |
30998 |
T |
 |
| Q |
216 |
gttaa |
220 |
Q |
| |
|
||||| |
|
|
| T |
30999 |
gttaa |
31003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University