View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17911_high_20 (Length: 224)

Name: NF17911_high_20
Description: NF17911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17911_high_20
NF17911_high_20
[»] chr3 (1 HSPs)
chr3 (20-208)||(35551685-35551873)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 35551685 - 35551873
Alignment:
20 acctgagaatcttctccatcaatccaacatcgggttgatggagaggatgagaggtgtaagactgccatttcagcagactttcgcaatgaaggaagaggct 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35551685 acctgagaatcttctccatcaatccaacatcgggttgatggagaggatgagaggtgtaagactgccatttcagcagactttcgcaatgaaggaagaggct 35551784  T
120 gtgaccaacttgaatttcgtgaggaagcggaagatctctggcgagtttaacatgatggatccgaaaattttcacttgccaacactctac 208  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35551785 gtgaccaacttggatttcgtgaggaagcggaagatctctggcgagtttaacatgatggatccgaaaattttcacttgccaacactctac 35551873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University