View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17911_high_9 (Length: 381)
Name: NF17911_high_9
Description: NF17911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17911_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 333
Target Start/End: Complemental strand, 23369041 - 23368726
Alignment:
| Q |
18 |
gttatgtcaagggacttgcgttgttcatggttaaaaatgatttggttgttgaaccaatgtctcttagttcagctttttctcttctcaatcgtgtgaaaac |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23369041 |
gttatgtcaagggacctgcgttgttcatggttaaaaatgatttggttgttgaaccaatgtctcttagttcagctttttctcttctcaatcgtgtgaaaac |
23368942 |
T |
|
| Q |
118 |
tccgcctagtaacttgacagaaaaggttgtcttcattggtgtcaaggaggtatcaagggtgctatgtatgccttgtacatttatatctgcctaactaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23368941 |
tccgcctagtaacttgacagaaaaggttgtcttcattggtgtcaaggaggtatcaagggtgctatgtatgccttgtacatttatatctgcctaactaaac |
23368842 |
T |
|
| Q |
218 |
cttggtttattttcttacttctcttattccttgatcaagtattaagaaaccttacgttttgacattgatgtagatgcacaatctcatataaacaactatc |
317 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23368841 |
cttggtttattttcttacttctcttatcccttgatcaagtattaagaaaccttactttttgacattgatgtagatgcacaatctcatataaacaactatc |
23368742 |
T |
|
| Q |
318 |
ataagtaggcttactc |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23368741 |
ataagtaggcttactc |
23368726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 39 - 169
Target Start/End: Original strand, 29414497 - 29414627
Alignment:
| Q |
39 |
tgttcatggttaaaaatgatttggttgttgaaccaatgtctcttagttcagctttttctcttctcaatcgtgtgaaaactccgcctagtaacttgacaga |
138 |
Q |
| |
|
|||||||| ||| ||||||||||||| | ||||||||||||| | ||||||||| ||||| ||||||||| | ||||||| |||||||| |||| || |
|
|
| T |
29414497 |
tgttcatgattacaaatgatttggttatagaaccaatgtctcaaatttcagctttatctctactcaatcgtttcgaaactcctcctagtaatgtgactga |
29414596 |
T |
|
| Q |
139 |
aaaggttgtcttcattggtgtcaaggaggta |
169 |
Q |
| |
|
||| | ||||||||||||| ||| ||||||| |
|
|
| T |
29414597 |
aaaagatgtcttcattggtctcatggaggta |
29414627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University