View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17912_high_13 (Length: 215)

Name: NF17912_high_13
Description: NF17912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17912_high_13
NF17912_high_13
[»] chr5 (1 HSPs)
chr5 (37-195)||(29042761-29042919)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 37 - 195
Target Start/End: Complemental strand, 29042919 - 29042761
Alignment:
37 agtaatggtcatagcaatggagcttcaactattgtcaccgacttagatgagttttctttgcaaaaagatgaagaacttgaaaagaaaagaaatgttggtg 136  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29042919 agtaatggtcatagcaatggaacttcaacaattgtcaccgacttagatgagttttctttgcaaaaagatgaagaacttgaaaagaaaagaaatgttggtg 29042820  T
137 aatgtaacagtgataaagaacaagattgtgtacctgttggacttggactagttgctaat 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29042819 aatgtaacagtgataaagaacaagattgtgtacctgttggacttggactagttgctaat 29042761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University