View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17912_low_12 (Length: 245)
Name: NF17912_low_12
Description: NF17912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17912_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 76 - 222
Target Start/End: Complemental strand, 33106878 - 33106732
Alignment:
| Q |
76 |
ttgttcggaagtgaagtagcttggtccatgtgaccttgagggaagtagtaaaccctagaattgacggtagggatttgcacggcggcgccggcgatagctc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106878 |
ttgttcggaagtgaagtagcttggtccatgtgaccttgagggaagtagtaaaccctagaattgacggtagggatttgcacggcggcgccggcgatagctc |
33106779 |
T |
 |
| Q |
176 |
gccagagttttgggttgagtgaggatgcgttttttggtgacggtggt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106778 |
gccagagttttgggttgagtgaggatgcgttttttggtgacggtggt |
33106732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University