View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17912_low_12 (Length: 245)

Name: NF17912_low_12
Description: NF17912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17912_low_12
NF17912_low_12
[»] chr3 (1 HSPs)
chr3 (76-222)||(33106732-33106878)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 76 - 222
Target Start/End: Complemental strand, 33106878 - 33106732
Alignment:
76 ttgttcggaagtgaagtagcttggtccatgtgaccttgagggaagtagtaaaccctagaattgacggtagggatttgcacggcggcgccggcgatagctc 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33106878 ttgttcggaagtgaagtagcttggtccatgtgaccttgagggaagtagtaaaccctagaattgacggtagggatttgcacggcggcgccggcgatagctc 33106779  T
176 gccagagttttgggttgagtgaggatgcgttttttggtgacggtggt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
33106778 gccagagttttgggttgagtgaggatgcgttttttggtgacggtggt 33106732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University