View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17912_low_15 (Length: 215)
Name: NF17912_low_15
Description: NF17912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17912_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 37 - 195
Target Start/End: Complemental strand, 29042919 - 29042761
Alignment:
| Q |
37 |
agtaatggtcatagcaatggagcttcaactattgtcaccgacttagatgagttttctttgcaaaaagatgaagaacttgaaaagaaaagaaatgttggtg |
136 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29042919 |
agtaatggtcatagcaatggaacttcaacaattgtcaccgacttagatgagttttctttgcaaaaagatgaagaacttgaaaagaaaagaaatgttggtg |
29042820 |
T |
 |
| Q |
137 |
aatgtaacagtgataaagaacaagattgtgtacctgttggacttggactagttgctaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29042819 |
aatgtaacagtgataaagaacaagattgtgtacctgttggacttggactagttgctaat |
29042761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University