View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17912_low_4 (Length: 353)
Name: NF17912_low_4
Description: NF17912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17912_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 21 - 147
Target Start/End: Original strand, 46359794 - 46359920
Alignment:
| Q |
21 |
agatgtgaaatccattctcaacgatgatggttcgttcaacgaagctgcttccgaagcatttccaatttacaacaaatcacacttcattgttctttcaatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46359794 |
agatgtgaaatccattctcaacgatgatggttcgttcaacgaagctgcttccgaagcatttccaatttacaacaaatcacacttcattgttctttcaatg |
46359893 |
T |
 |
| Q |
121 |
cctgaccgaagcggagatgtaactaac |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46359894 |
cctgaccgaagcggagatgtaactaac |
46359920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 224 - 339
Target Start/End: Original strand, 46359998 - 46360113
Alignment:
| Q |
224 |
cggatcagtatcatgctatatgaatatatgattgataaatcaatttgtattttcttatgtaaaacacaaatcccctgacttaggaatctgctgcatgcag |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46359998 |
cggatcagtatcatgctatatgaatatatgattgataaatcaatttgtattttcttatgtaaaacacaaatcccctgacttaggaatctgctgcatgcag |
46360097 |
T |
 |
| Q |
324 |
gtactggttacttcat |
339 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46360098 |
gtactggttacttcat |
46360113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University