View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17913_high_10 (Length: 329)
Name: NF17913_high_10
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17913_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 14 - 310
Target Start/End: Original strand, 39991670 - 39991965
Alignment:
| Q |
14 |
agatgaaacaataacggtcaaagacaaaaaacgctatgaagaatagacagacacaacaccaacaccaacatgtaaacattggtaacaatttgaggaaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991670 |
agatgaaacaataacggtcaaagacaaaaaacgctatgaagaatagacagacacaacaccgacaccaacatgtaaacattggtaacaatttgaggaaatt |
39991769 |
T |
 |
| Q |
114 |
taattggttgaaaatgatcaaatgtgttggtgtccgacatcaacatctattggacaccagacatacattcgatctgcagtactgcatatcaaatgtgctc |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991770 |
taattggttgaaaatgat-aaatgtgttggtgtccgacatcgacatctattggacaccagacatacattcgatctgcagtactgcatatcaaatgtgctc |
39991868 |
T |
 |
| Q |
214 |
tagcatcaaataagggattaagtttagaaaacattatgtcatatcctcaaatatctctcnnnnnnnnntagaaaagttcaagcttcaaccaattttg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39991869 |
tagcatcaaataagggattaagtttagaaaacattatgtcatatcctcaaatatctctcaaaaaaaaatagaaaagttcaagcttcaaccaattttg |
39991965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University