View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17913_high_19 (Length: 229)
Name: NF17913_high_19
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17913_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 36039464 - 36039507
Alignment:
| Q |
170 |
tatatatatagtaatcatctagtactcttttttgttgttgaagc |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36039464 |
tatatatatattaatcatctagtactcttttttgttgttgaagc |
36039507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University