View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17913_low_15 (Length: 259)
Name: NF17913_low_15
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17913_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 112 - 246
Target Start/End: Original strand, 45163506 - 45163640
Alignment:
| Q |
112 |
gttatgatgatatgatcaattttccttcattgtggtggatgtgacaannnnnnngttgacatgtacaactctcaagtttgttttctgaaaaatgttttct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
45163506 |
gttacgatgatatgatcaattttccttcattgtggtggatgtgacaatttttttgttgacatgtacaactcacaagtttgttttctgaaaaatgtattct |
45163605 |
T |
 |
| Q |
212 |
ttcttgcaattgaaggatgttatattgtacaattt |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
45163606 |
ttcttgcaattgaaggatgttaaattgtacaattt |
45163640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 45163408 - 45163464
Alignment:
| Q |
11 |
ataatactaaaatgctaataagttctgaacttgaaagttgaaaccctgaactagaaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45163408 |
ataatactaaaatgctaataagttctgaacttgaaagttgaaaccctgaactagaaa |
45163464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University