View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17913_low_15 (Length: 259)

Name: NF17913_low_15
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17913_low_15
NF17913_low_15
[»] chr2 (2 HSPs)
chr2 (112-246)||(45163506-45163640)
chr2 (11-67)||(45163408-45163464)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 112 - 246
Target Start/End: Original strand, 45163506 - 45163640
Alignment:
112 gttatgatgatatgatcaattttccttcattgtggtggatgtgacaannnnnnngttgacatgtacaactctcaagtttgttttctgaaaaatgttttct 211  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||| ||||||||||||||||||||||| ||||    
45163506 gttacgatgatatgatcaattttccttcattgtggtggatgtgacaatttttttgttgacatgtacaactcacaagtttgttttctgaaaaatgtattct 45163605  T
212 ttcttgcaattgaaggatgttatattgtacaattt 246  Q
    |||||||||||||||||||||| ||||||||||||    
45163606 ttcttgcaattgaaggatgttaaattgtacaattt 45163640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 45163408 - 45163464
Alignment:
11 ataatactaaaatgctaataagttctgaacttgaaagttgaaaccctgaactagaaa 67  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45163408 ataatactaaaatgctaataagttctgaacttgaaagttgaaaccctgaactagaaa 45163464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University