View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17913_low_21 (Length: 227)
Name: NF17913_low_21
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17913_low_21 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 1697383 - 1697607
Alignment:
| Q |
6 |
aaaaacaagttactataattttagttgaaatctattcgcttatagcagaaaatttcaaaatgaagtatttataaaatgaaattggttttttctttaagga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1697383 |
aaaaacaagttactataattttagttgaaatctattcgcttatagcagaaaatttcaaaatgaagtatttataaaatgaaattggttttttctttaagga |
1697482 |
T |
|
| Q |
106 |
gttattgaacaaaataccgatctatatctcaactagatgaaaagtaaattgagaaagtgggttgatttcttttgg---nnnnnnnnatatgggaccccat |
202 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
1697483 |
gttatcgaacaaaataccaatatatatctcaactagaggaaaagtaaattgagaaagtgggttgatttcttttggtttttttttttatatgggacctcat |
1697582 |
T |
|
| Q |
203 |
ttatacgcatataagtcatatctct |
227 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
1697583 |
ttatacgcatatgagtcatatctct |
1697607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 73 - 180
Target Start/End: Original strand, 1689580 - 1689685
Alignment:
| Q |
73 |
tttataaaatgaaattggttttttctttaaggagttattgaacaaaataccgatctatatctcaactagatgaaaagtaaattgagaaagtgggttgatt |
172 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||| ||| || |||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
1689580 |
tttatgaaatgaaattggttttttctttgaggagttattgaacaaaacaccaat--atatctcaacaagaggaaaagtaaattgagaaagtgggtcgatt |
1689677 |
T |
|
| Q |
173 |
tcttttgg |
180 |
Q |
| |
|
|||||||| |
|
|
| T |
1689678 |
tcttttgg |
1689685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University