View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17915_low_17 (Length: 288)
Name: NF17915_low_17
Description: NF17915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17915_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 37293356 - 37293200
Alignment:
| Q |
1 |
tcctaaaccttgtgtatgttggcttgaaatataaaccaagattgcttgccnnnnnnnctatactgtgttaatattaatcttgcaacaataatttcctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37293356 |
tcctaaaccttgtgtatgttggcttgaaatataaaccaagattgcttgcctttttttctatactgtgttaatattaatcttgcaacaataatttcctaac |
37293257 |
T |
 |
| Q |
101 |
caagaaggatggaatctaaatatttcagtatagacaaatttgtgtcaatactgttac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37293256 |
caagaaggatggaatctaaatatttcagcatagacaaatttgtgtcaatactgttac |
37293200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 218 - 277
Target Start/End: Complemental strand, 37293139 - 37293080
Alignment:
| Q |
218 |
tgttatttacttaggtaggtgaattaaattgatcatctaagctctggtcacgtcgccttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37293139 |
tgttatttacttaggtaggtgaattaaattgatcatctaagctctggtcacgtcgccttt |
37293080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University